Prelich lab yeast Systematic Overexpression Library methods

The following methods are being used in our lab for the production and use of a yeast systematic overexpression plasmid library that was published in Jones et al. Nature Methods (2008; in press). On this site we provide additional information about the methods that we have used to produce the plasmid DNAs and to transform them into yeast for genetic overexpression screens, including updates from the published protocols and answers to frequently asked questions. We welcome and strongly encourage your feedback on the protocols described here, and any improvements in the methods will be posted for the benefit of others and gratefully acknowledged.

Library information and
DNA production

Library transformation and
screening protocols

Frequently asked questions
Prelich lab home page



Library information and DNA production

BACKGROUND AND LIBRARY CONTENT.  Our library contains a systematic collection of the yeast (Saccharomyces cerevisiae) genome in a 2m-based LEU2 vector, primarily constructed to facilitate comprehensive overexpression screens.  A minimal tiling path of plasmids that spans across the genome was assembled, consisting of 1,588 plasmids with the average insert containing 10.8 kb and ~5 genes per plasmid. This collection contains >97% of the yeast genome on the physical level, and covers >95% of annotated yeast genes at the functional level.  For a gene to be considered intact, we required a window of 500 bp upstream of the translation start codon and 100 bp downstream of the translation stop codon to ensure that sufficient regulatory sequences for expression were present. 

This library has several advantages over random libraries and GAL1 promoter-driven overexpression: (1) The systematic nature of this library is an enormous advantage over random libraries, allowing efficient and comprehensive screens for overexpression phenotypes, eliminating concerns about the quality of the library or the number of transformants screened. (2)
The reasonably small number of plasmids allows systematic screens by direct transformation without any robots.  (3) Because the library can be directly transformed into cells, the only genetic requirement for the recipient strain is a genomic leu2 mutation to allow selection of transformants. (4) All genes are untagged and expressed from their native promoters.  (5) Because the library consists of genomic fragments that span multiple genes, the inserts contain all chromosomal elements, including protein-coding genes, non-protein-coding genes, intergenic regions, centromeres, and ARSs. (5) Relatively few examples of lethal plasmids are observed.

We are continuing to improve and expand this library, with an ongoing project to fill the remaining physical and functional gaps, and to transfer all the inserts to a CEN URA3 vector, thereby creating a matching pair of complete 2m and CEN libraries of the yeast genome (thanks to financial support from the National Science Foundation).  The library is being distributed by Open Biosystems, which is supplying the library as frozen bacterial stocks in a 96-well plate format (18 plates). You can access the Open Biosystems web page for this library here.

PREPARING THE DNA.  Our library was constructed in a vector called pGP564, which contains the kanamycin-resistance casette for selection in bacteria and a pBR322-based origin of replication for bacterial propagation.  This plasmid therefore produces less DNA than the pUC-based ultra-high yield vectors.  Using Qiagen plasmid purification kits, we have been getting an average of 5 micrograms of plasmid DNA from an overnight 10 ml bacterial culture grown in LB containing 50 mg/ml of kanamycin. After DNA is produced it is probably worth creating a set of plates with each plasmid DNA diluted to ~10-20 ng per microliter, both to equalize the plasmid concentrations and to avoid using excess DNA during the transformations.  Because we currently use ~60 ng of each plasmid for 96-well transformations, working plates of plasmids in this concentration range should be most efficient to generate transformants for overexpression screens.
    Some labs are simply pinning the bacterial collection on to LB + Kan plates, scraping the cells, and preparing the DNA in a single pool for each of the 17 plates. Aliquots of the 17 DNA preps can then be pooled together in equal concentrations to produce a high quality
2m library with considerably less effort than producing all of the DNAs individually.  We have not taken that approach yet, but this is certainly a reasonable alternative.

pGP564 map



Library transformation and screening protocols

The overexpression screens performed in the Jones et al. paper used ~180 ng of each plasmid. The following modified procedure generates transformants more efficiently, allowing the use of less plasmid DNA per transformation.  It is recommended that any strain being used in an overexpression screen is first tested on a small scale to determine its transformation efficiency before using library DNA in the 96-well format.  This is especially true for temperature-sensitive mutants, since this transformation procedure incorporates a 42oC heat shock step. We recommed beginning with 1 or 2 plates first to ensure that the procedure is working well for you before scaling up to do multiple plates.  We are currently transforming 9 plates at a time, although with experience it should be reasonable to transform all 18 plates in one day. The following procedure, which was adapted from Gietz and Woods (2005) Methods Mol. Biol. 313, 107-120, describes the transformation of a single plate, but can be easily scaled up as needed. For additional information on yeast transformation, the best source is Dan Gietz's yeast transformation web site.

A printer-friendly PDF file of the transformation procedure can be obtained here.

(Note: put a shaking platform in an incubator and adjust the temperature to 42oC before starting the transformation)
1.  Grow an overnight yeast culture
to ~2 x 107 cells per ml in YPD liquid medium.  We use ~4 x 107 cells/well of transformation, and therefore need a 200 ml culture grown to ~2 x 107 cells per ml for each 96-well plate.

2.  Harvest the cells in 50 ml conical tubes at 2500 rpm for 5 minutes in a tabletop centrifuge or 4K rpm for 5 min in Sorvall.

3.  Dump the YPD medium. To remove the remaining YPD, wash the cells
by resuspending the pellets in sterile water, combining the cells into one tube, and pelleting again as above.

4.
Dump the water, and wash the cells once with sterile 0.1M LiOAc.

5.  Pellet the cells, dump out the 0.1M LiOAc, and resuspend the cells in fresh sterile 0.1M LiOAc to final volume of 1 ml per 96-well plate.

6.  Add the 1 ml cell suspension to TRAFO mix (see table below) and gently mix to disperse.  We assemble the TRAFO mix in a sterile beaker containing a sterile stir bar to facilitate mixing of the viscous solution. After the cells are adequately dispersed in the TRAFO mix, aliquot 150 ml of the transformation mix to each well of a Falcon #3077 plate using a 12-channel pipetter and
a sterile tray. Each well should have ~4 x 107 cells.

7.  Add plasmid DNA to each well using a 12-channel pipetter. We are currently using ~60 ng of plasmid DNA per well, but adjust this amount to the transformation efficiency of your strain. Some of the DNA plates should have empty wells; in those plate positions you could add control vector or any positive controls that reverse the mutant phenotype of your starting strain.

8.  Incubate plates at 42oC for 1 hour on a shaking platform at ~220 rpm (optimal incubation time might be strain-dependent, test each strain before doing the large-scale transformation). The Gietz transformation protocol recommends 3 hr at
42oC, but we found no difference between 1 hour and 3 hour incubations; the shorter incubation might help to get transformants when using slowly growing strains.

9.  Pellet cells in the 96-well Falcon plate at 2500 rpm for 5 minutes at room temp; remove the TRAFO mix with a multipipetter, ensuring to not to disturb the pellet.

10.  Add 15 ml sterile water to each well, and resuspend the pellet by shaking on multi-vortexer for ~2 minutes at a setting that will resuspend the cells without splashing into adjacent wells.

11.  Spot 7 ml of the resuspended cells onto SC-Leucine plates to select for transformants.  We use a 12-channel pipetter to spot the cells, typically spotting duplicate rows onto the SC-Leu plate, offset at a 45 degree angle. To help generating evenly spaced rows, the plate is first lightly touched with a sterile 96-prong replicator
(V&P scientific #VP407) leaving a light imprint of the replicator positions in the agar, using the V&P #381 tray copier to position the spots. The cells are then spotted onto that imprint using the multi-channel pipetter.  We use Nunc Omni-plates (Nunc # 242811) filled with ~35 ml of SC-Leu agar.

12. Incubate plates 
at 30oC until transformants appear.  With the relatively large number of cells plated per spot, background growth can be relatively high.  Note that the transformation method used in the Jones et al paper resulted in low background growth but required higher amounts of plasmid DNA. We also find that tranformants near the center of the plate take longer to appear than the transformants near the edge of the plate, but other labs report similar edge effects. We have not figured out how to get uniform growth.  If you have ideas on how to get more uniform growth of transformants across the entire plate, please pass them along.

13. After the transformants appear, we first transfer them into 150
ml of sterile water in Falcon #3072 plates using the VP407 96-prong replicator. The cells are dispersed in the water by gently shaking on a platform shaker for ~2 minutes.

14.  The dispersed cells are pinned to selective plates in duplicate rows
using the VP407 96-prong replicator. We pin them twice onto each spot to ensure even distribution of the cells.

15.  Hope, pray, chant, perform the secret genticist's dance, or wish upon a star that a few plasmids generate the desired phenotype. Note that some plasmids might not generate transformants in your mutant background. These could be due to simple pipetting errors during the large-scale transformation, but they could also be examples of synthetic dosage lethality (SDL)(see Meth. Enzymol 350: 316-326)
where overexpression causes lethality in a specific mutant background, but not in wild-type cells.

16.  Re-transform any suppressor or SDL candidates individually by your standard transformation protocol to confirm the overexpression phenotype.


TRAFO mix recipe:
# of 96-well plates: 1 2 4 9 18 per well
50% PEG3350 10 ml 20 ml 40 ml 90 ml 180 ml 100 ml
1M LiOAc 1.5 ml 3 ml 6 ml 13.5 ml 27 ml 15 ml
H2O 0.5 ml 1 ml 2 ml 4.5 ml 9 ml 5 ml
2 mg/ml carrier DNA 2 ml 4 ml 8 ml 18 ml 36 ml 20 ml
washed cells 1 ml 2 ml 4 ml 9 ml 18 ml 10 ml
total volume
15 ml 30 ml 60 ml 135 ml 270 ml 150 ml


Notes: 
1.  Carrier DNA is a 2 mg/ml stock of salmon sperm DNA (Sigma D1626) boiled for 10 minutes, then put on ice for 5 minutes.  It doesn’t have to be boiled fresh every time, but don’t keep freezing and thawing it either.
2.  Have an incubator at 42oC before starting the procedure.


Solutions:
1M LiOAc  =  51g LiOAC.2H2O +  ~463 mls H2O  pH should be between pH 8.4 - 8.9; filter sterilize or autoclave.
50% PEG 3350  =  125g PEG 3350 + ~145 ml H2O (to 250 ml final vol.) Heat at low setting to get PEG into solution. Autoclave to sterilize.

Some Results:

Transformation plate photo        Plate 14 hit



Frequently asked questions
Where can we obtain the library?
The library is being distributed by Open Biosystems, which is supplying the library as frozen bacterial stocks in a 96-well plate format (18 plates). The library is also being distributed as a pool of DNA, with each plasmid present in the pool at relatively equivalent concentration.

How much DNA is typically needed to get sufficient transformants in a 96-well transformation protocol?
For a wild-type strain or healthy strains that transform at wild-type efficiency, we have been using ~60 ng of plasmid DNA per transformation.

Where can we send comments on our experience with the library and these protocols?
We encourage users to tell us about your experiences with this library (both positive and negative). The plan is to incorporate useful suggestions or improvements or recurring problems and questions into this web site to help other users.  To send comments, click here.

Can we visualize the distribution of the plasmids on the yeast genome?
The location of library plasmids can be visualized at the Ensembl yeast web site. If the plasmids are not displayed after you select a chromosome and a chromosomal region, go to the
the "Detailed View" window and ensure that "YGPM plasmid library" is checked under the "DAS sources" menu.  The white boxes correspond to the minimal tiling path plasmids; the yellow boxes are the redundant plasmids from our original dense plasmid collection. Clicking on the plasmid should display the plasmid nucleotide endpoints and a list of genes contained on the plasmid.

Which genes are missing from the library?
An Excel file containing worksheets that provide details on the library plasmids, the physical gaps, the missing genes, etc. can be downloaded by clicking here.

Is the dense collection available?
Although in principle, there are no objections to distributing the entire collection, practical issues make it difficult to distribute the dense collection of 7,777 plasmids. The minimal collection of 1,588 plasmids, which contains a subset of the dense collection that spans the genome in a minimal tiling path, was deemed to be of the greatest use to most users, and also is less expensive than distributing the entire dense 7,777 plasmid collection.

Are the clone endpoints updated when the reference sequence changes?
No. The clone endpoints, gene totals, and gene names are based on the S. cerevisiae reference sequence that existed when the sequencing of the clones was performed (Oct.17, 2005 SGD annotations). Although we would like to have the annotations updated constantly, this task is beyond the current capabilities of our lab. We welcome suggestions on how to keep the annotations updated.

Where can I get the pGP564 vector?
Contact me. Open Biosystems is also providing the plasmid. pGP564 is also included in the kit with the pooled plasmid DNA.

What primers can be used to sequence the insert-vector junctions?
The Sanger Institute did the vast majority of the sequencing, using the following two primers: M13-48 (=pUC18R = M13-21R)
5' AGCGGATAACAATTTCACACAGGA 3',  and  5' TAAGTTGGGTAACGCCAGGG 3'.

Is a CEN (low copy number) version of the library available?
A CEN version is not currently available, but a project to fill the gaps in the current library and to transfer the inserts to a CEN vector is in progress. If all goes according to plans, the CEN collection should become available in 2009.

Is the 2m library available in vectors with other selectable markers?
There are currently no plans to transfer the inserts to other 2
m vectors.  Because pGP564 has attL sites flanking the inserts, transfer of inserts to other vectors can be accomplished using the Gateway reagents and appropriate Gateway-compatible recipient vectors.  Additional information on the Gateway system can be obtained here.

What plates do you use?
For transformation we use Falcon 3077 96-well plates. The round bottom gives tighter pellets.
For selection of transformants, we use Nunc Omni plates
(Nunc # 242811) filled with ~ 35 ml of SC-Leu agar.
For dilution of transformants for the final screen we use Falcon 3072 flat-bottomed plates
, although the Falcon 3077 plates should work fine too.


Library information and
DNA production

Library transformation and
screening protocols

Frequently asked questions
Prelich lab home page


last updated 2/6/2008